Review



d systems 1324 wnp 010 chemical compound  (R&D Systems)


Bioz Verified Symbol R&D Systems is a verified supplier
Bioz Manufacturer Symbol R&D Systems manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    R&D Systems d systems 1324 wnp 010 chemical compound
    D Systems 1324 Wnp 010 Chemical Compound, supplied by R&D Systems, used in various techniques. Bioz Stars score: 90/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/d+systems+1324+wnp+010+chemical+compound/Recombinant+Mouse+Wnt-3a+(High+Purity)+Protein/10__7554_slash_elife__69199-295-39-37
    Average 90 stars, based on 5 article reviews
    d systems 1324 wnp 010 chemical compound - by Bioz Stars, 2026-09
    90/100 stars

    Images

    Related Articles

    Sequencing:

    Article Title: The amyloid precursor protein is a conserved Wnt receptor
    Article Snippet: DOI: https://doi.org/10.7554/eLife.69199 16 of 26 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Antibody Mouse monoclonal anti-rab11a Santa Cruz Cat# sc-166523, RRID:AB_2173466 IF (1:20) Antibody Mouse monoclonal anti- Golgin-97 Invitrogen Cat# A-21270, RRID:AB_221447 IF (1:100) WB (1:1000) Antibody Rat monoclonal anti-Lamp1 Santa Cruz Cat# sc-19992, RRID:AB_2134495 IF (1:20) WB (1:200) Antibody Chicken polyclonal anti-GFP Abcam Cat# ab13970, RRID:AB_300798 IF (1:200) Antibody Guinea pig Polyclonal antiserum anti-Ankyrin G Synaptic Systems Cat# 386004 RRID:AB_2725774 IF (1:100) Antibody Rabbit Polyclonal Anti-V5 Millipore Cat# AB3792 RRID:AB_91591 IP (1:20) WB (1:1000) Antibody Rat Monoclonal Anti-DYKDDDDK Epitope Tag Novus Cat# NBP1-06712 RRID:AB_1625981 IP (1:20) WB (1:1000) Antibody Mouse Monoclonal Anti-c-Myc Sigma-Aldrich Cat# M4439 RRID:AB_439694 IP (1:20) WB (1:1000) Antibody Goat anti-Chicken IgY (H+L), Alexa Fluor488 Invitrogen Cat# A-11039, RRID:AB_142924 IF (1:500) Antibody Goat anti-Rabbit IgG (H+L), Alexa Fluor488 Invitrogen Cat# A-11008, RRID:AB_143165 IF (1:500) Antibody Goat anti-Rat IgG (H+L), Alexa Fluor488 Invitrogen Cat# A-11006, RRID:AB_141373 IF (1:500) Antibody Goat anti- Mouse IgG (H+L), Alexa Fluor488 Invitrogen Cat# A-11029, RRID:AB_138404 IF (1:500) Antibody Goat anti-Rabbit IgG (H+L), Alexa Fluor555 Invitrogen Cat# A-11034, RRID:AB_2576217 IF (1:500) Antibody Goat anti-Guinea Pig IgG (H+L), Alexa Fluor555 Invitrogen Cat# A-21435, RRID:AB_2535856 IF (1:500) Antibody Peroxidase AffiniPure Donkey Anti-Mouse IgG (H+L) Jackson Immuno Research Labs Cat# 715-035-150, RRID:AB_2340770 WB (1:4000) Antibody Peroxidase AffiniPure Donkey Anti-Rabbit IgG (H+L) Jackson Immuno Research Labs Cat# 711-035-152, RRID:AB_10015282 WB (1:4000) Antibody Peroxidase AffiniPure Donkey Anti-Rat IgG (H+L) Jackson Immuno Research Labs Cat# 712-035-153, RRID:AB_2340639 WB (1:4000) Chemical compound, drug Triton X-100 Sigma Cat#X100 In PBS 0.1% Chemical compound, drug Trizol Reagent Invitrogen Cat#15596026 Chemical compound, drug L15 medium Gibco 11415064 Medium for embryo brain isolation on ice Chemical compound, drug Mounting Medium Vector Laboratories Cat#H-1000 Chemical compound, drug 0.05% trypsin/EDTA Gibco 25300–054 Chemical compound, drug SVF Invitrogen 10270106 Chemical compound, drug DNAse Serlabo LS002138 Chemical compound, drug Neurobasal medium Gibco 21103049 Chemical compound, drug B27 supplement Gibco 17504–044 Continued on next page Liu et al. eLife 2021;10:e69199. .. DOI: https://doi.org/10.7554/eLife.69199 17 of 26 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Chemical compound, drug L-glutamax Gibco 35050–061 Chemical compound, drug Wnt3a R and D Systems 645-WN-010 Chemical compound, drug Wnt5a R and D Systems 1324-WNP-010 Chemical compound, drug Bafilomycin A1 invitrogen 88899-55-2 Chemical compound, drug LY294002 Sigma L9908 Chemical compound, drug Lipofectamine 3000 Thermofisher Cat#L3000008 Chemical compound, drug DMEM Gibco Cat#10566016 Chemical compound, drug Penicillin-Streptomycin Gibco Cat#15140122 Biological sample (M. musculus) APP-KO mouse A gift from Bart De Strooper’s lab N/A Cell line (Homo-sapiens) Hek293 A gift from Marie-Claude Potier’s lab N/A Sequence-based reagent mAPP_F This paper Ordered from IDT PCR primers CATCCAGAACTGGTGCAAGCG Sequence-based reagent mAPP_R This paper Ordered from IDT PCR primers GACGGTGTGCCAGTGAAGATG Sequence-based reagent b-actin _F This paper Ordered from IDT er PCR primers TCCATCATGAAGTGTGACGT Sequence-based reagent b-actin _R This paper Ordered from IDT r PCR primers GAGCAATGATCTTGATCTTCAT Transfected construct (M. musculus) pLv-pSyn1mAPP-Flag-IRESeGFP ICM-institute, Virus facility N/A Lentiviral construct to transfect and express the mAPP Transfected construct (M. musculus) pLv-pSyn1mAPPDCRD-Flag-IRESeGFP ICM-institute, Virus facility N/A Lentiviral construct to transfect and express the mAPP-DCRD Transfected construct (M. musculus) pLv-pSyn1- eGFP ICM-institute, Virus facility N/A Lentiviral construct to transfect and express the GFP Transfected construct (M. musculus) pCDNA3mApp-FLAG-IRES-eGFP This paper N/A transfected construct Transfected construct (M. musculus) pCDNA3-mAPPDCRDFLAG-IRES-eGFP This paper N/A transfected construct Transfected construct (M. musculus) pCDNA3-Wnt5a-myc This paper N/A transfected construct Transfected construct (M. musculus) pCDNA-Wnt3A-V5 This paper N/A transfected construct Transfected construct (human) pCDNA3-hAppFLAG-IRES-eGFP This paper N/A transfected construct Transfected construct (human) pCDNA3-hAPPDCRDFLAG-IRES-eGFP This paper N/A transfected construct Commercial assay or kit QuantiTect Reverse Transcription Kit Qiagen Cat# 205311 Commercial assay or kit LightCycler480 SYBR Green I Master Roche Cat# 04707516001 Commercial assay or kit 4–12% polyacrylamide gels (SDS-PAGE) ThermoFisher NW04122BOX Continued on next page Liu et al. eLife 2021;10:e69199. .. DOI: https://doi.org/10.7554/eLife.69199 18 of 26 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Commercial assay or kit Protein G sepharose beads ThermoFisher Ref.10612D Lot.00644644 Other Nikon A1-R Other Olympus FV-1200 Other DAPI Sigma Cat# D9564 1 ug/ml Software, algorithm GraphPad Prism software GraphPad Prism (https://graphpad.com) RRID:SCR_015807 Software, algorithm ImageJ software ImageJ (http://imagej.nih.gov/ij/) RRID:SCR_003070 Drosophila stocks and maintenance Flies were raised at 25 ̊C, on standard cornmeal and molasses medium.

    Polymerase Chain Reaction:

    Article Title: The amyloid precursor protein is a conserved Wnt receptor
    Article Snippet: DOI: https://doi.org/10.7554/eLife.69199 16 of 26 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Antibody Mouse monoclonal anti-rab11a Santa Cruz Cat# sc-166523, RRID:AB_2173466 IF (1:20) Antibody Mouse monoclonal anti- Golgin-97 Invitrogen Cat# A-21270, RRID:AB_221447 IF (1:100) WB (1:1000) Antibody Rat monoclonal anti-Lamp1 Santa Cruz Cat# sc-19992, RRID:AB_2134495 IF (1:20) WB (1:200) Antibody Chicken polyclonal anti-GFP Abcam Cat# ab13970, RRID:AB_300798 IF (1:200) Antibody Guinea pig Polyclonal antiserum anti-Ankyrin G Synaptic Systems Cat# 386004 RRID:AB_2725774 IF (1:100) Antibody Rabbit Polyclonal Anti-V5 Millipore Cat# AB3792 RRID:AB_91591 IP (1:20) WB (1:1000) Antibody Rat Monoclonal Anti-DYKDDDDK Epitope Tag Novus Cat# NBP1-06712 RRID:AB_1625981 IP (1:20) WB (1:1000) Antibody Mouse Monoclonal Anti-c-Myc Sigma-Aldrich Cat# M4439 RRID:AB_439694 IP (1:20) WB (1:1000) Antibody Goat anti-Chicken IgY (H+L), Alexa Fluor488 Invitrogen Cat# A-11039, RRID:AB_142924 IF (1:500) Antibody Goat anti-Rabbit IgG (H+L), Alexa Fluor488 Invitrogen Cat# A-11008, RRID:AB_143165 IF (1:500) Antibody Goat anti-Rat IgG (H+L), Alexa Fluor488 Invitrogen Cat# A-11006, RRID:AB_141373 IF (1:500) Antibody Goat anti- Mouse IgG (H+L), Alexa Fluor488 Invitrogen Cat# A-11029, RRID:AB_138404 IF (1:500) Antibody Goat anti-Rabbit IgG (H+L), Alexa Fluor555 Invitrogen Cat# A-11034, RRID:AB_2576217 IF (1:500) Antibody Goat anti-Guinea Pig IgG (H+L), Alexa Fluor555 Invitrogen Cat# A-21435, RRID:AB_2535856 IF (1:500) Antibody Peroxidase AffiniPure Donkey Anti-Mouse IgG (H+L) Jackson Immuno Research Labs Cat# 715-035-150, RRID:AB_2340770 WB (1:4000) Antibody Peroxidase AffiniPure Donkey Anti-Rabbit IgG (H+L) Jackson Immuno Research Labs Cat# 711-035-152, RRID:AB_10015282 WB (1:4000) Antibody Peroxidase AffiniPure Donkey Anti-Rat IgG (H+L) Jackson Immuno Research Labs Cat# 712-035-153, RRID:AB_2340639 WB (1:4000) Chemical compound, drug Triton X-100 Sigma Cat#X100 In PBS 0.1% Chemical compound, drug Trizol Reagent Invitrogen Cat#15596026 Chemical compound, drug L15 medium Gibco 11415064 Medium for embryo brain isolation on ice Chemical compound, drug Mounting Medium Vector Laboratories Cat#H-1000 Chemical compound, drug 0.05% trypsin/EDTA Gibco 25300–054 Chemical compound, drug SVF Invitrogen 10270106 Chemical compound, drug DNAse Serlabo LS002138 Chemical compound, drug Neurobasal medium Gibco 21103049 Chemical compound, drug B27 supplement Gibco 17504–044 Continued on next page Liu et al. eLife 2021;10:e69199. .. DOI: https://doi.org/10.7554/eLife.69199 17 of 26 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Chemical compound, drug L-glutamax Gibco 35050–061 Chemical compound, drug Wnt3a R and D Systems 645-WN-010 Chemical compound, drug Wnt5a R and D Systems 1324-WNP-010 Chemical compound, drug Bafilomycin A1 invitrogen 88899-55-2 Chemical compound, drug LY294002 Sigma L9908 Chemical compound, drug Lipofectamine 3000 Thermofisher Cat#L3000008 Chemical compound, drug DMEM Gibco Cat#10566016 Chemical compound, drug Penicillin-Streptomycin Gibco Cat#15140122 Biological sample (M. musculus) APP-KO mouse A gift from Bart De Strooper’s lab N/A Cell line (Homo-sapiens) Hek293 A gift from Marie-Claude Potier’s lab N/A Sequence-based reagent mAPP_F This paper Ordered from IDT PCR primers CATCCAGAACTGGTGCAAGCG Sequence-based reagent mAPP_R This paper Ordered from IDT PCR primers GACGGTGTGCCAGTGAAGATG Sequence-based reagent b-actin _F This paper Ordered from IDT er PCR primers TCCATCATGAAGTGTGACGT Sequence-based reagent b-actin _R This paper Ordered from IDT r PCR primers GAGCAATGATCTTGATCTTCAT Transfected construct (M. musculus) pLv-pSyn1mAPP-Flag-IRESeGFP ICM-institute, Virus facility N/A Lentiviral construct to transfect and express the mAPP Transfected construct (M. musculus) pLv-pSyn1mAPPDCRD-Flag-IRESeGFP ICM-institute, Virus facility N/A Lentiviral construct to transfect and express the mAPP-DCRD Transfected construct (M. musculus) pLv-pSyn1- eGFP ICM-institute, Virus facility N/A Lentiviral construct to transfect and express the GFP Transfected construct (M. musculus) pCDNA3mApp-FLAG-IRES-eGFP This paper N/A transfected construct Transfected construct (M. musculus) pCDNA3-mAPPDCRDFLAG-IRES-eGFP This paper N/A transfected construct Transfected construct (M. musculus) pCDNA3-Wnt5a-myc This paper N/A transfected construct Transfected construct (M. musculus) pCDNA-Wnt3A-V5 This paper N/A transfected construct Transfected construct (human) pCDNA3-hAppFLAG-IRES-eGFP This paper N/A transfected construct Transfected construct (human) pCDNA3-hAPPDCRDFLAG-IRES-eGFP This paper N/A transfected construct Commercial assay or kit QuantiTect Reverse Transcription Kit Qiagen Cat# 205311 Commercial assay or kit LightCycler480 SYBR Green I Master Roche Cat# 04707516001 Commercial assay or kit 4–12% polyacrylamide gels (SDS-PAGE) ThermoFisher NW04122BOX Continued on next page Liu et al. eLife 2021;10:e69199. .. DOI: https://doi.org/10.7554/eLife.69199 18 of 26 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Commercial assay or kit Protein G sepharose beads ThermoFisher Ref.10612D Lot.00644644 Other Nikon A1-R Other Olympus FV-1200 Other DAPI Sigma Cat# D9564 1 ug/ml Software, algorithm GraphPad Prism software GraphPad Prism (https://graphpad.com) RRID:SCR_015807 Software, algorithm ImageJ software ImageJ (http://imagej.nih.gov/ij/) RRID:SCR_003070 Drosophila stocks and maintenance Flies were raised at 25 ̊C, on standard cornmeal and molasses medium.

    Transfection:

    Article Title: The amyloid precursor protein is a conserved Wnt receptor
    Article Snippet: DOI: https://doi.org/10.7554/eLife.69199 16 of 26 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Antibody Mouse monoclonal anti-rab11a Santa Cruz Cat# sc-166523, RRID:AB_2173466 IF (1:20) Antibody Mouse monoclonal anti- Golgin-97 Invitrogen Cat# A-21270, RRID:AB_221447 IF (1:100) WB (1:1000) Antibody Rat monoclonal anti-Lamp1 Santa Cruz Cat# sc-19992, RRID:AB_2134495 IF (1:20) WB (1:200) Antibody Chicken polyclonal anti-GFP Abcam Cat# ab13970, RRID:AB_300798 IF (1:200) Antibody Guinea pig Polyclonal antiserum anti-Ankyrin G Synaptic Systems Cat# 386004 RRID:AB_2725774 IF (1:100) Antibody Rabbit Polyclonal Anti-V5 Millipore Cat# AB3792 RRID:AB_91591 IP (1:20) WB (1:1000) Antibody Rat Monoclonal Anti-DYKDDDDK Epitope Tag Novus Cat# NBP1-06712 RRID:AB_1625981 IP (1:20) WB (1:1000) Antibody Mouse Monoclonal Anti-c-Myc Sigma-Aldrich Cat# M4439 RRID:AB_439694 IP (1:20) WB (1:1000) Antibody Goat anti-Chicken IgY (H+L), Alexa Fluor488 Invitrogen Cat# A-11039, RRID:AB_142924 IF (1:500) Antibody Goat anti-Rabbit IgG (H+L), Alexa Fluor488 Invitrogen Cat# A-11008, RRID:AB_143165 IF (1:500) Antibody Goat anti-Rat IgG (H+L), Alexa Fluor488 Invitrogen Cat# A-11006, RRID:AB_141373 IF (1:500) Antibody Goat anti- Mouse IgG (H+L), Alexa Fluor488 Invitrogen Cat# A-11029, RRID:AB_138404 IF (1:500) Antibody Goat anti-Rabbit IgG (H+L), Alexa Fluor555 Invitrogen Cat# A-11034, RRID:AB_2576217 IF (1:500) Antibody Goat anti-Guinea Pig IgG (H+L), Alexa Fluor555 Invitrogen Cat# A-21435, RRID:AB_2535856 IF (1:500) Antibody Peroxidase AffiniPure Donkey Anti-Mouse IgG (H+L) Jackson Immuno Research Labs Cat# 715-035-150, RRID:AB_2340770 WB (1:4000) Antibody Peroxidase AffiniPure Donkey Anti-Rabbit IgG (H+L) Jackson Immuno Research Labs Cat# 711-035-152, RRID:AB_10015282 WB (1:4000) Antibody Peroxidase AffiniPure Donkey Anti-Rat IgG (H+L) Jackson Immuno Research Labs Cat# 712-035-153, RRID:AB_2340639 WB (1:4000) Chemical compound, drug Triton X-100 Sigma Cat#X100 In PBS 0.1% Chemical compound, drug Trizol Reagent Invitrogen Cat#15596026 Chemical compound, drug L15 medium Gibco 11415064 Medium for embryo brain isolation on ice Chemical compound, drug Mounting Medium Vector Laboratories Cat#H-1000 Chemical compound, drug 0.05% trypsin/EDTA Gibco 25300–054 Chemical compound, drug SVF Invitrogen 10270106 Chemical compound, drug DNAse Serlabo LS002138 Chemical compound, drug Neurobasal medium Gibco 21103049 Chemical compound, drug B27 supplement Gibco 17504–044 Continued on next page Liu et al. eLife 2021;10:e69199. .. DOI: https://doi.org/10.7554/eLife.69199 17 of 26 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Chemical compound, drug L-glutamax Gibco 35050–061 Chemical compound, drug Wnt3a R and D Systems 645-WN-010 Chemical compound, drug Wnt5a R and D Systems 1324-WNP-010 Chemical compound, drug Bafilomycin A1 invitrogen 88899-55-2 Chemical compound, drug LY294002 Sigma L9908 Chemical compound, drug Lipofectamine 3000 Thermofisher Cat#L3000008 Chemical compound, drug DMEM Gibco Cat#10566016 Chemical compound, drug Penicillin-Streptomycin Gibco Cat#15140122 Biological sample (M. musculus) APP-KO mouse A gift from Bart De Strooper’s lab N/A Cell line (Homo-sapiens) Hek293 A gift from Marie-Claude Potier’s lab N/A Sequence-based reagent mAPP_F This paper Ordered from IDT PCR primers CATCCAGAACTGGTGCAAGCG Sequence-based reagent mAPP_R This paper Ordered from IDT PCR primers GACGGTGTGCCAGTGAAGATG Sequence-based reagent b-actin _F This paper Ordered from IDT er PCR primers TCCATCATGAAGTGTGACGT Sequence-based reagent b-actin _R This paper Ordered from IDT r PCR primers GAGCAATGATCTTGATCTTCAT Transfected construct (M. musculus) pLv-pSyn1mAPP-Flag-IRESeGFP ICM-institute, Virus facility N/A Lentiviral construct to transfect and express the mAPP Transfected construct (M. musculus) pLv-pSyn1mAPPDCRD-Flag-IRESeGFP ICM-institute, Virus facility N/A Lentiviral construct to transfect and express the mAPP-DCRD Transfected construct (M. musculus) pLv-pSyn1- eGFP ICM-institute, Virus facility N/A Lentiviral construct to transfect and express the GFP Transfected construct (M. musculus) pCDNA3mApp-FLAG-IRES-eGFP This paper N/A transfected construct Transfected construct (M. musculus) pCDNA3-mAPPDCRDFLAG-IRES-eGFP This paper N/A transfected construct Transfected construct (M. musculus) pCDNA3-Wnt5a-myc This paper N/A transfected construct Transfected construct (M. musculus) pCDNA-Wnt3A-V5 This paper N/A transfected construct Transfected construct (human) pCDNA3-hAppFLAG-IRES-eGFP This paper N/A transfected construct Transfected construct (human) pCDNA3-hAPPDCRDFLAG-IRES-eGFP This paper N/A transfected construct Commercial assay or kit QuantiTect Reverse Transcription Kit Qiagen Cat# 205311 Commercial assay or kit LightCycler480 SYBR Green I Master Roche Cat# 04707516001 Commercial assay or kit 4–12% polyacrylamide gels (SDS-PAGE) ThermoFisher NW04122BOX Continued on next page Liu et al. eLife 2021;10:e69199. .. DOI: https://doi.org/10.7554/eLife.69199 18 of 26 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Commercial assay or kit Protein G sepharose beads ThermoFisher Ref.10612D Lot.00644644 Other Nikon A1-R Other Olympus FV-1200 Other DAPI Sigma Cat# D9564 1 ug/ml Software, algorithm GraphPad Prism software GraphPad Prism (https://graphpad.com) RRID:SCR_015807 Software, algorithm ImageJ software ImageJ (http://imagej.nih.gov/ij/) RRID:SCR_003070 Drosophila stocks and maintenance Flies were raised at 25 ̊C, on standard cornmeal and molasses medium.

    Construct:

    Article Title: The amyloid precursor protein is a conserved Wnt receptor
    Article Snippet: DOI: https://doi.org/10.7554/eLife.69199 16 of 26 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Antibody Mouse monoclonal anti-rab11a Santa Cruz Cat# sc-166523, RRID:AB_2173466 IF (1:20) Antibody Mouse monoclonal anti- Golgin-97 Invitrogen Cat# A-21270, RRID:AB_221447 IF (1:100) WB (1:1000) Antibody Rat monoclonal anti-Lamp1 Santa Cruz Cat# sc-19992, RRID:AB_2134495 IF (1:20) WB (1:200) Antibody Chicken polyclonal anti-GFP Abcam Cat# ab13970, RRID:AB_300798 IF (1:200) Antibody Guinea pig Polyclonal antiserum anti-Ankyrin G Synaptic Systems Cat# 386004 RRID:AB_2725774 IF (1:100) Antibody Rabbit Polyclonal Anti-V5 Millipore Cat# AB3792 RRID:AB_91591 IP (1:20) WB (1:1000) Antibody Rat Monoclonal Anti-DYKDDDDK Epitope Tag Novus Cat# NBP1-06712 RRID:AB_1625981 IP (1:20) WB (1:1000) Antibody Mouse Monoclonal Anti-c-Myc Sigma-Aldrich Cat# M4439 RRID:AB_439694 IP (1:20) WB (1:1000) Antibody Goat anti-Chicken IgY (H+L), Alexa Fluor488 Invitrogen Cat# A-11039, RRID:AB_142924 IF (1:500) Antibody Goat anti-Rabbit IgG (H+L), Alexa Fluor488 Invitrogen Cat# A-11008, RRID:AB_143165 IF (1:500) Antibody Goat anti-Rat IgG (H+L), Alexa Fluor488 Invitrogen Cat# A-11006, RRID:AB_141373 IF (1:500) Antibody Goat anti- Mouse IgG (H+L), Alexa Fluor488 Invitrogen Cat# A-11029, RRID:AB_138404 IF (1:500) Antibody Goat anti-Rabbit IgG (H+L), Alexa Fluor555 Invitrogen Cat# A-11034, RRID:AB_2576217 IF (1:500) Antibody Goat anti-Guinea Pig IgG (H+L), Alexa Fluor555 Invitrogen Cat# A-21435, RRID:AB_2535856 IF (1:500) Antibody Peroxidase AffiniPure Donkey Anti-Mouse IgG (H+L) Jackson Immuno Research Labs Cat# 715-035-150, RRID:AB_2340770 WB (1:4000) Antibody Peroxidase AffiniPure Donkey Anti-Rabbit IgG (H+L) Jackson Immuno Research Labs Cat# 711-035-152, RRID:AB_10015282 WB (1:4000) Antibody Peroxidase AffiniPure Donkey Anti-Rat IgG (H+L) Jackson Immuno Research Labs Cat# 712-035-153, RRID:AB_2340639 WB (1:4000) Chemical compound, drug Triton X-100 Sigma Cat#X100 In PBS 0.1% Chemical compound, drug Trizol Reagent Invitrogen Cat#15596026 Chemical compound, drug L15 medium Gibco 11415064 Medium for embryo brain isolation on ice Chemical compound, drug Mounting Medium Vector Laboratories Cat#H-1000 Chemical compound, drug 0.05% trypsin/EDTA Gibco 25300–054 Chemical compound, drug SVF Invitrogen 10270106 Chemical compound, drug DNAse Serlabo LS002138 Chemical compound, drug Neurobasal medium Gibco 21103049 Chemical compound, drug B27 supplement Gibco 17504–044 Continued on next page Liu et al. eLife 2021;10:e69199. .. DOI: https://doi.org/10.7554/eLife.69199 17 of 26 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Chemical compound, drug L-glutamax Gibco 35050–061 Chemical compound, drug Wnt3a R and D Systems 645-WN-010 Chemical compound, drug Wnt5a R and D Systems 1324-WNP-010 Chemical compound, drug Bafilomycin A1 invitrogen 88899-55-2 Chemical compound, drug LY294002 Sigma L9908 Chemical compound, drug Lipofectamine 3000 Thermofisher Cat#L3000008 Chemical compound, drug DMEM Gibco Cat#10566016 Chemical compound, drug Penicillin-Streptomycin Gibco Cat#15140122 Biological sample (M. musculus) APP-KO mouse A gift from Bart De Strooper’s lab N/A Cell line (Homo-sapiens) Hek293 A gift from Marie-Claude Potier’s lab N/A Sequence-based reagent mAPP_F This paper Ordered from IDT PCR primers CATCCAGAACTGGTGCAAGCG Sequence-based reagent mAPP_R This paper Ordered from IDT PCR primers GACGGTGTGCCAGTGAAGATG Sequence-based reagent b-actin _F This paper Ordered from IDT er PCR primers TCCATCATGAAGTGTGACGT Sequence-based reagent b-actin _R This paper Ordered from IDT r PCR primers GAGCAATGATCTTGATCTTCAT Transfected construct (M. musculus) pLv-pSyn1mAPP-Flag-IRESeGFP ICM-institute, Virus facility N/A Lentiviral construct to transfect and express the mAPP Transfected construct (M. musculus) pLv-pSyn1mAPPDCRD-Flag-IRESeGFP ICM-institute, Virus facility N/A Lentiviral construct to transfect and express the mAPP-DCRD Transfected construct (M. musculus) pLv-pSyn1- eGFP ICM-institute, Virus facility N/A Lentiviral construct to transfect and express the GFP Transfected construct (M. musculus) pCDNA3mApp-FLAG-IRES-eGFP This paper N/A transfected construct Transfected construct (M. musculus) pCDNA3-mAPPDCRDFLAG-IRES-eGFP This paper N/A transfected construct Transfected construct (M. musculus) pCDNA3-Wnt5a-myc This paper N/A transfected construct Transfected construct (M. musculus) pCDNA-Wnt3A-V5 This paper N/A transfected construct Transfected construct (human) pCDNA3-hAppFLAG-IRES-eGFP This paper N/A transfected construct Transfected construct (human) pCDNA3-hAPPDCRDFLAG-IRES-eGFP This paper N/A transfected construct Commercial assay or kit QuantiTect Reverse Transcription Kit Qiagen Cat# 205311 Commercial assay or kit LightCycler480 SYBR Green I Master Roche Cat# 04707516001 Commercial assay or kit 4–12% polyacrylamide gels (SDS-PAGE) ThermoFisher NW04122BOX Continued on next page Liu et al. eLife 2021;10:e69199. .. DOI: https://doi.org/10.7554/eLife.69199 18 of 26 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Commercial assay or kit Protein G sepharose beads ThermoFisher Ref.10612D Lot.00644644 Other Nikon A1-R Other Olympus FV-1200 Other DAPI Sigma Cat# D9564 1 ug/ml Software, algorithm GraphPad Prism software GraphPad Prism (https://graphpad.com) RRID:SCR_015807 Software, algorithm ImageJ software ImageJ (http://imagej.nih.gov/ij/) RRID:SCR_003070 Drosophila stocks and maintenance Flies were raised at 25 ̊C, on standard cornmeal and molasses medium.

    Virus:

    Article Title: The amyloid precursor protein is a conserved Wnt receptor
    Article Snippet: DOI: https://doi.org/10.7554/eLife.69199 16 of 26 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Antibody Mouse monoclonal anti-rab11a Santa Cruz Cat# sc-166523, RRID:AB_2173466 IF (1:20) Antibody Mouse monoclonal anti- Golgin-97 Invitrogen Cat# A-21270, RRID:AB_221447 IF (1:100) WB (1:1000) Antibody Rat monoclonal anti-Lamp1 Santa Cruz Cat# sc-19992, RRID:AB_2134495 IF (1:20) WB (1:200) Antibody Chicken polyclonal anti-GFP Abcam Cat# ab13970, RRID:AB_300798 IF (1:200) Antibody Guinea pig Polyclonal antiserum anti-Ankyrin G Synaptic Systems Cat# 386004 RRID:AB_2725774 IF (1:100) Antibody Rabbit Polyclonal Anti-V5 Millipore Cat# AB3792 RRID:AB_91591 IP (1:20) WB (1:1000) Antibody Rat Monoclonal Anti-DYKDDDDK Epitope Tag Novus Cat# NBP1-06712 RRID:AB_1625981 IP (1:20) WB (1:1000) Antibody Mouse Monoclonal Anti-c-Myc Sigma-Aldrich Cat# M4439 RRID:AB_439694 IP (1:20) WB (1:1000) Antibody Goat anti-Chicken IgY (H+L), Alexa Fluor488 Invitrogen Cat# A-11039, RRID:AB_142924 IF (1:500) Antibody Goat anti-Rabbit IgG (H+L), Alexa Fluor488 Invitrogen Cat# A-11008, RRID:AB_143165 IF (1:500) Antibody Goat anti-Rat IgG (H+L), Alexa Fluor488 Invitrogen Cat# A-11006, RRID:AB_141373 IF (1:500) Antibody Goat anti- Mouse IgG (H+L), Alexa Fluor488 Invitrogen Cat# A-11029, RRID:AB_138404 IF (1:500) Antibody Goat anti-Rabbit IgG (H+L), Alexa Fluor555 Invitrogen Cat# A-11034, RRID:AB_2576217 IF (1:500) Antibody Goat anti-Guinea Pig IgG (H+L), Alexa Fluor555 Invitrogen Cat# A-21435, RRID:AB_2535856 IF (1:500) Antibody Peroxidase AffiniPure Donkey Anti-Mouse IgG (H+L) Jackson Immuno Research Labs Cat# 715-035-150, RRID:AB_2340770 WB (1:4000) Antibody Peroxidase AffiniPure Donkey Anti-Rabbit IgG (H+L) Jackson Immuno Research Labs Cat# 711-035-152, RRID:AB_10015282 WB (1:4000) Antibody Peroxidase AffiniPure Donkey Anti-Rat IgG (H+L) Jackson Immuno Research Labs Cat# 712-035-153, RRID:AB_2340639 WB (1:4000) Chemical compound, drug Triton X-100 Sigma Cat#X100 In PBS 0.1% Chemical compound, drug Trizol Reagent Invitrogen Cat#15596026 Chemical compound, drug L15 medium Gibco 11415064 Medium for embryo brain isolation on ice Chemical compound, drug Mounting Medium Vector Laboratories Cat#H-1000 Chemical compound, drug 0.05% trypsin/EDTA Gibco 25300–054 Chemical compound, drug SVF Invitrogen 10270106 Chemical compound, drug DNAse Serlabo LS002138 Chemical compound, drug Neurobasal medium Gibco 21103049 Chemical compound, drug B27 supplement Gibco 17504–044 Continued on next page Liu et al. eLife 2021;10:e69199. .. DOI: https://doi.org/10.7554/eLife.69199 17 of 26 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Chemical compound, drug L-glutamax Gibco 35050–061 Chemical compound, drug Wnt3a R and D Systems 645-WN-010 Chemical compound, drug Wnt5a R and D Systems 1324-WNP-010 Chemical compound, drug Bafilomycin A1 invitrogen 88899-55-2 Chemical compound, drug LY294002 Sigma L9908 Chemical compound, drug Lipofectamine 3000 Thermofisher Cat#L3000008 Chemical compound, drug DMEM Gibco Cat#10566016 Chemical compound, drug Penicillin-Streptomycin Gibco Cat#15140122 Biological sample (M. musculus) APP-KO mouse A gift from Bart De Strooper’s lab N/A Cell line (Homo-sapiens) Hek293 A gift from Marie-Claude Potier’s lab N/A Sequence-based reagent mAPP_F This paper Ordered from IDT PCR primers CATCCAGAACTGGTGCAAGCG Sequence-based reagent mAPP_R This paper Ordered from IDT PCR primers GACGGTGTGCCAGTGAAGATG Sequence-based reagent b-actin _F This paper Ordered from IDT er PCR primers TCCATCATGAAGTGTGACGT Sequence-based reagent b-actin _R This paper Ordered from IDT r PCR primers GAGCAATGATCTTGATCTTCAT Transfected construct (M. musculus) pLv-pSyn1mAPP-Flag-IRESeGFP ICM-institute, Virus facility N/A Lentiviral construct to transfect and express the mAPP Transfected construct (M. musculus) pLv-pSyn1mAPPDCRD-Flag-IRESeGFP ICM-institute, Virus facility N/A Lentiviral construct to transfect and express the mAPP-DCRD Transfected construct (M. musculus) pLv-pSyn1- eGFP ICM-institute, Virus facility N/A Lentiviral construct to transfect and express the GFP Transfected construct (M. musculus) pCDNA3mApp-FLAG-IRES-eGFP This paper N/A transfected construct Transfected construct (M. musculus) pCDNA3-mAPPDCRDFLAG-IRES-eGFP This paper N/A transfected construct Transfected construct (M. musculus) pCDNA3-Wnt5a-myc This paper N/A transfected construct Transfected construct (M. musculus) pCDNA-Wnt3A-V5 This paper N/A transfected construct Transfected construct (human) pCDNA3-hAppFLAG-IRES-eGFP This paper N/A transfected construct Transfected construct (human) pCDNA3-hAPPDCRDFLAG-IRES-eGFP This paper N/A transfected construct Commercial assay or kit QuantiTect Reverse Transcription Kit Qiagen Cat# 205311 Commercial assay or kit LightCycler480 SYBR Green I Master Roche Cat# 04707516001 Commercial assay or kit 4–12% polyacrylamide gels (SDS-PAGE) ThermoFisher NW04122BOX Continued on next page Liu et al. eLife 2021;10:e69199. .. DOI: https://doi.org/10.7554/eLife.69199 18 of 26 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Commercial assay or kit Protein G sepharose beads ThermoFisher Ref.10612D Lot.00644644 Other Nikon A1-R Other Olympus FV-1200 Other DAPI Sigma Cat# D9564 1 ug/ml Software, algorithm GraphPad Prism software GraphPad Prism (https://graphpad.com) RRID:SCR_015807 Software, algorithm ImageJ software ImageJ (http://imagej.nih.gov/ij/) RRID:SCR_003070 Drosophila stocks and maintenance Flies were raised at 25 ̊C, on standard cornmeal and molasses medium.

    Reverse Transcription:

    Article Title: The amyloid precursor protein is a conserved Wnt receptor
    Article Snippet: DOI: https://doi.org/10.7554/eLife.69199 16 of 26 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Antibody Mouse monoclonal anti-rab11a Santa Cruz Cat# sc-166523, RRID:AB_2173466 IF (1:20) Antibody Mouse monoclonal anti- Golgin-97 Invitrogen Cat# A-21270, RRID:AB_221447 IF (1:100) WB (1:1000) Antibody Rat monoclonal anti-Lamp1 Santa Cruz Cat# sc-19992, RRID:AB_2134495 IF (1:20) WB (1:200) Antibody Chicken polyclonal anti-GFP Abcam Cat# ab13970, RRID:AB_300798 IF (1:200) Antibody Guinea pig Polyclonal antiserum anti-Ankyrin G Synaptic Systems Cat# 386004 RRID:AB_2725774 IF (1:100) Antibody Rabbit Polyclonal Anti-V5 Millipore Cat# AB3792 RRID:AB_91591 IP (1:20) WB (1:1000) Antibody Rat Monoclonal Anti-DYKDDDDK Epitope Tag Novus Cat# NBP1-06712 RRID:AB_1625981 IP (1:20) WB (1:1000) Antibody Mouse Monoclonal Anti-c-Myc Sigma-Aldrich Cat# M4439 RRID:AB_439694 IP (1:20) WB (1:1000) Antibody Goat anti-Chicken IgY (H+L), Alexa Fluor488 Invitrogen Cat# A-11039, RRID:AB_142924 IF (1:500) Antibody Goat anti-Rabbit IgG (H+L), Alexa Fluor488 Invitrogen Cat# A-11008, RRID:AB_143165 IF (1:500) Antibody Goat anti-Rat IgG (H+L), Alexa Fluor488 Invitrogen Cat# A-11006, RRID:AB_141373 IF (1:500) Antibody Goat anti- Mouse IgG (H+L), Alexa Fluor488 Invitrogen Cat# A-11029, RRID:AB_138404 IF (1:500) Antibody Goat anti-Rabbit IgG (H+L), Alexa Fluor555 Invitrogen Cat# A-11034, RRID:AB_2576217 IF (1:500) Antibody Goat anti-Guinea Pig IgG (H+L), Alexa Fluor555 Invitrogen Cat# A-21435, RRID:AB_2535856 IF (1:500) Antibody Peroxidase AffiniPure Donkey Anti-Mouse IgG (H+L) Jackson Immuno Research Labs Cat# 715-035-150, RRID:AB_2340770 WB (1:4000) Antibody Peroxidase AffiniPure Donkey Anti-Rabbit IgG (H+L) Jackson Immuno Research Labs Cat# 711-035-152, RRID:AB_10015282 WB (1:4000) Antibody Peroxidase AffiniPure Donkey Anti-Rat IgG (H+L) Jackson Immuno Research Labs Cat# 712-035-153, RRID:AB_2340639 WB (1:4000) Chemical compound, drug Triton X-100 Sigma Cat#X100 In PBS 0.1% Chemical compound, drug Trizol Reagent Invitrogen Cat#15596026 Chemical compound, drug L15 medium Gibco 11415064 Medium for embryo brain isolation on ice Chemical compound, drug Mounting Medium Vector Laboratories Cat#H-1000 Chemical compound, drug 0.05% trypsin/EDTA Gibco 25300–054 Chemical compound, drug SVF Invitrogen 10270106 Chemical compound, drug DNAse Serlabo LS002138 Chemical compound, drug Neurobasal medium Gibco 21103049 Chemical compound, drug B27 supplement Gibco 17504–044 Continued on next page Liu et al. eLife 2021;10:e69199. .. DOI: https://doi.org/10.7554/eLife.69199 17 of 26 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Chemical compound, drug L-glutamax Gibco 35050–061 Chemical compound, drug Wnt3a R and D Systems 645-WN-010 Chemical compound, drug Wnt5a R and D Systems 1324-WNP-010 Chemical compound, drug Bafilomycin A1 invitrogen 88899-55-2 Chemical compound, drug LY294002 Sigma L9908 Chemical compound, drug Lipofectamine 3000 Thermofisher Cat#L3000008 Chemical compound, drug DMEM Gibco Cat#10566016 Chemical compound, drug Penicillin-Streptomycin Gibco Cat#15140122 Biological sample (M. musculus) APP-KO mouse A gift from Bart De Strooper’s lab N/A Cell line (Homo-sapiens) Hek293 A gift from Marie-Claude Potier’s lab N/A Sequence-based reagent mAPP_F This paper Ordered from IDT PCR primers CATCCAGAACTGGTGCAAGCG Sequence-based reagent mAPP_R This paper Ordered from IDT PCR primers GACGGTGTGCCAGTGAAGATG Sequence-based reagent b-actin _F This paper Ordered from IDT er PCR primers TCCATCATGAAGTGTGACGT Sequence-based reagent b-actin _R This paper Ordered from IDT r PCR primers GAGCAATGATCTTGATCTTCAT Transfected construct (M. musculus) pLv-pSyn1mAPP-Flag-IRESeGFP ICM-institute, Virus facility N/A Lentiviral construct to transfect and express the mAPP Transfected construct (M. musculus) pLv-pSyn1mAPPDCRD-Flag-IRESeGFP ICM-institute, Virus facility N/A Lentiviral construct to transfect and express the mAPP-DCRD Transfected construct (M. musculus) pLv-pSyn1- eGFP ICM-institute, Virus facility N/A Lentiviral construct to transfect and express the GFP Transfected construct (M. musculus) pCDNA3mApp-FLAG-IRES-eGFP This paper N/A transfected construct Transfected construct (M. musculus) pCDNA3-mAPPDCRDFLAG-IRES-eGFP This paper N/A transfected construct Transfected construct (M. musculus) pCDNA3-Wnt5a-myc This paper N/A transfected construct Transfected construct (M. musculus) pCDNA-Wnt3A-V5 This paper N/A transfected construct Transfected construct (human) pCDNA3-hAppFLAG-IRES-eGFP This paper N/A transfected construct Transfected construct (human) pCDNA3-hAPPDCRDFLAG-IRES-eGFP This paper N/A transfected construct Commercial assay or kit QuantiTect Reverse Transcription Kit Qiagen Cat# 205311 Commercial assay or kit LightCycler480 SYBR Green I Master Roche Cat# 04707516001 Commercial assay or kit 4–12% polyacrylamide gels (SDS-PAGE) ThermoFisher NW04122BOX Continued on next page Liu et al. eLife 2021;10:e69199. .. DOI: https://doi.org/10.7554/eLife.69199 18 of 26 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Commercial assay or kit Protein G sepharose beads ThermoFisher Ref.10612D Lot.00644644 Other Nikon A1-R Other Olympus FV-1200 Other DAPI Sigma Cat# D9564 1 ug/ml Software, algorithm GraphPad Prism software GraphPad Prism (https://graphpad.com) RRID:SCR_015807 Software, algorithm ImageJ software ImageJ (http://imagej.nih.gov/ij/) RRID:SCR_003070 Drosophila stocks and maintenance Flies were raised at 25 ̊C, on standard cornmeal and molasses medium.

    SYBR Green Assay:

    Article Title: The amyloid precursor protein is a conserved Wnt receptor
    Article Snippet: DOI: https://doi.org/10.7554/eLife.69199 16 of 26 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Antibody Mouse monoclonal anti-rab11a Santa Cruz Cat# sc-166523, RRID:AB_2173466 IF (1:20) Antibody Mouse monoclonal anti- Golgin-97 Invitrogen Cat# A-21270, RRID:AB_221447 IF (1:100) WB (1:1000) Antibody Rat monoclonal anti-Lamp1 Santa Cruz Cat# sc-19992, RRID:AB_2134495 IF (1:20) WB (1:200) Antibody Chicken polyclonal anti-GFP Abcam Cat# ab13970, RRID:AB_300798 IF (1:200) Antibody Guinea pig Polyclonal antiserum anti-Ankyrin G Synaptic Systems Cat# 386004 RRID:AB_2725774 IF (1:100) Antibody Rabbit Polyclonal Anti-V5 Millipore Cat# AB3792 RRID:AB_91591 IP (1:20) WB (1:1000) Antibody Rat Monoclonal Anti-DYKDDDDK Epitope Tag Novus Cat# NBP1-06712 RRID:AB_1625981 IP (1:20) WB (1:1000) Antibody Mouse Monoclonal Anti-c-Myc Sigma-Aldrich Cat# M4439 RRID:AB_439694 IP (1:20) WB (1:1000) Antibody Goat anti-Chicken IgY (H+L), Alexa Fluor488 Invitrogen Cat# A-11039, RRID:AB_142924 IF (1:500) Antibody Goat anti-Rabbit IgG (H+L), Alexa Fluor488 Invitrogen Cat# A-11008, RRID:AB_143165 IF (1:500) Antibody Goat anti-Rat IgG (H+L), Alexa Fluor488 Invitrogen Cat# A-11006, RRID:AB_141373 IF (1:500) Antibody Goat anti- Mouse IgG (H+L), Alexa Fluor488 Invitrogen Cat# A-11029, RRID:AB_138404 IF (1:500) Antibody Goat anti-Rabbit IgG (H+L), Alexa Fluor555 Invitrogen Cat# A-11034, RRID:AB_2576217 IF (1:500) Antibody Goat anti-Guinea Pig IgG (H+L), Alexa Fluor555 Invitrogen Cat# A-21435, RRID:AB_2535856 IF (1:500) Antibody Peroxidase AffiniPure Donkey Anti-Mouse IgG (H+L) Jackson Immuno Research Labs Cat# 715-035-150, RRID:AB_2340770 WB (1:4000) Antibody Peroxidase AffiniPure Donkey Anti-Rabbit IgG (H+L) Jackson Immuno Research Labs Cat# 711-035-152, RRID:AB_10015282 WB (1:4000) Antibody Peroxidase AffiniPure Donkey Anti-Rat IgG (H+L) Jackson Immuno Research Labs Cat# 712-035-153, RRID:AB_2340639 WB (1:4000) Chemical compound, drug Triton X-100 Sigma Cat#X100 In PBS 0.1% Chemical compound, drug Trizol Reagent Invitrogen Cat#15596026 Chemical compound, drug L15 medium Gibco 11415064 Medium for embryo brain isolation on ice Chemical compound, drug Mounting Medium Vector Laboratories Cat#H-1000 Chemical compound, drug 0.05% trypsin/EDTA Gibco 25300–054 Chemical compound, drug SVF Invitrogen 10270106 Chemical compound, drug DNAse Serlabo LS002138 Chemical compound, drug Neurobasal medium Gibco 21103049 Chemical compound, drug B27 supplement Gibco 17504–044 Continued on next page Liu et al. eLife 2021;10:e69199. .. DOI: https://doi.org/10.7554/eLife.69199 17 of 26 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Chemical compound, drug L-glutamax Gibco 35050–061 Chemical compound, drug Wnt3a R and D Systems 645-WN-010 Chemical compound, drug Wnt5a R and D Systems 1324-WNP-010 Chemical compound, drug Bafilomycin A1 invitrogen 88899-55-2 Chemical compound, drug LY294002 Sigma L9908 Chemical compound, drug Lipofectamine 3000 Thermofisher Cat#L3000008 Chemical compound, drug DMEM Gibco Cat#10566016 Chemical compound, drug Penicillin-Streptomycin Gibco Cat#15140122 Biological sample (M. musculus) APP-KO mouse A gift from Bart De Strooper’s lab N/A Cell line (Homo-sapiens) Hek293 A gift from Marie-Claude Potier’s lab N/A Sequence-based reagent mAPP_F This paper Ordered from IDT PCR primers CATCCAGAACTGGTGCAAGCG Sequence-based reagent mAPP_R This paper Ordered from IDT PCR primers GACGGTGTGCCAGTGAAGATG Sequence-based reagent b-actin _F This paper Ordered from IDT er PCR primers TCCATCATGAAGTGTGACGT Sequence-based reagent b-actin _R This paper Ordered from IDT r PCR primers GAGCAATGATCTTGATCTTCAT Transfected construct (M. musculus) pLv-pSyn1mAPP-Flag-IRESeGFP ICM-institute, Virus facility N/A Lentiviral construct to transfect and express the mAPP Transfected construct (M. musculus) pLv-pSyn1mAPPDCRD-Flag-IRESeGFP ICM-institute, Virus facility N/A Lentiviral construct to transfect and express the mAPP-DCRD Transfected construct (M. musculus) pLv-pSyn1- eGFP ICM-institute, Virus facility N/A Lentiviral construct to transfect and express the GFP Transfected construct (M. musculus) pCDNA3mApp-FLAG-IRES-eGFP This paper N/A transfected construct Transfected construct (M. musculus) pCDNA3-mAPPDCRDFLAG-IRES-eGFP This paper N/A transfected construct Transfected construct (M. musculus) pCDNA3-Wnt5a-myc This paper N/A transfected construct Transfected construct (M. musculus) pCDNA-Wnt3A-V5 This paper N/A transfected construct Transfected construct (human) pCDNA3-hAppFLAG-IRES-eGFP This paper N/A transfected construct Transfected construct (human) pCDNA3-hAPPDCRDFLAG-IRES-eGFP This paper N/A transfected construct Commercial assay or kit QuantiTect Reverse Transcription Kit Qiagen Cat# 205311 Commercial assay or kit LightCycler480 SYBR Green I Master Roche Cat# 04707516001 Commercial assay or kit 4–12% polyacrylamide gels (SDS-PAGE) ThermoFisher NW04122BOX Continued on next page Liu et al. eLife 2021;10:e69199. .. DOI: https://doi.org/10.7554/eLife.69199 18 of 26 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Commercial assay or kit Protein G sepharose beads ThermoFisher Ref.10612D Lot.00644644 Other Nikon A1-R Other Olympus FV-1200 Other DAPI Sigma Cat# D9564 1 ug/ml Software, algorithm GraphPad Prism software GraphPad Prism (https://graphpad.com) RRID:SCR_015807 Software, algorithm ImageJ software ImageJ (http://imagej.nih.gov/ij/) RRID:SCR_003070 Drosophila stocks and maintenance Flies were raised at 25 ̊C, on standard cornmeal and molasses medium.



    Similar Products

    d systems 1324 wnp 010 chemical compound  (R&D Systems)
    90
    R&D Systems d systems 1324 wnp 010 chemical compound
    D Systems 1324 Wnp 010 Chemical Compound, supplied by R&D Systems, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/d+systems+1324+wnp+010+chemical+compound/Recombinant+Mouse+Wnt-3a+(High+Purity)+Protein/10__7554_slash_elife__69199-295-39-37
    Average 90 stars, based on 1 article reviews
    d systems 1324 wnp 010 chemical compound - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier

    Image Search Results